Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

Amelia R.I. Lindsey; Danny W. Rice; Sarah R. Bordenstein; Andrew W. Brooks; Seth R. Bordenstein; Irene L.G. Newton

doi:10.1093/gbe/evz079

Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

Amelia R.I. Lindsey, Danny W. Rice, Sarah R. Bordenstein, Andrew W. Brooks, Seth R. Bordenstein, Irene L.G. Newton

Research output: Contribution to journal › Comment/debate › peer-review

Abstract

Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.

Original language	English (US)
Pages (from-to)	1320
Number of pages	1
Journal	Genome biology and evolution
Volume	11
Issue number	4
DOIs	https://doi.org/10.1093/gbe/evz079
State	Published - Apr 1 2019

All Science Journal Classification (ASJC) codes

Ecology, Evolution, Behavior and Systematics
Genetics

Access to Document

10.1093/gbe/evz079

Cite this

Lindsey, A. R. I., Rice, D. W., Bordenstein, S. R., Brooks, A. W., Bordenstein, S. R., & Newton, I. L. G. (2019). Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012). Genome biology and evolution, 11(4), 1320. https://doi.org/10.1093/gbe/evz079

@article{3c82ad9a9583429ca6292286b9a9e470,

title = "Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)",

abstract = "Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.",

author = "Lindsey, {Amelia R.I.} and Rice, {Danny W.} and Bordenstein, {Sarah R.} and Brooks, {Andrew W.} and Bordenstein, {Seth R.} and Newton, {Irene L.G.}",

note = "Publisher Copyright: {\textcopyright} 2019 The Author(s). Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.",

year = "2019",

month = apr,

day = "1",

doi = "10.1093/gbe/evz079",

language = "English (US)",

volume = "11",

pages = "1320",

journal = "Genome biology and evolution",

issn = "1759-6653",

publisher = "Oxford University Press",

number = "4",

}

Lindsey, ARI, Rice, DW, Bordenstein, SR, Brooks, AW, Bordenstein, SR & Newton, ILG 2019, 'Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)', Genome biology and evolution, vol. 11, no. 4, pp. 1320. https://doi.org/10.1093/gbe/evz079

Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012). / Lindsey, Amelia R.I.; Rice, Danny W.; Bordenstein, Sarah R. et al.
In: Genome biology and evolution, Vol. 11, No. 4, 01.04.2019, p. 1320.

Research output: Contribution to journal › Comment/debate › peer-review

TY - JOUR

T1 - Corrigendum

T2 - Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

AU - Lindsey, Amelia R.I.

AU - Rice, Danny W.

AU - Bordenstein, Sarah R.

AU - Brooks, Andrew W.

AU - Bordenstein, Seth R.

AU - Newton, Irene L.G.

PY - 2019/4/1

Y1 - 2019/4/1

N2 - Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.

AB - Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.

UR - http://www.scopus.com/inward/record.url?scp=85065288078&partnerID=8YFLogxK

UR - http://www.scopus.com/inward/citedby.url?scp=85065288078&partnerID=8YFLogxK

U2 - 10.1093/gbe/evz079

DO - 10.1093/gbe/evz079

M3 - Comment/debate

C2 - 31028710

AN - SCOPUS:85065288078

SN - 1759-6653

VL - 11

SP - 1320

JO - Genome biology and evolution

JF - Genome biology and evolution

IS - 4

ER -

Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

Abstract

All Science Journal Classification (ASJC) codes

Access to Document

Other files and links

Fingerprint

Cite this