Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)

Research output: Contribution to journalComment/debatepeer-review

Abstract

Quantitative RT-PCR was one the assays we used to identify transcription of the cifA and cifB genes byWolbachia strain wMel. In our publication we included the incorrect sequence for two primers, cifAR and ftsZR. The correct sequences are below. cifAR: AGCAAAGCGTTCACATTTCC ftsZR:CCATTCCTGCTGTGATGAAA The authors regret this error.

Original languageEnglish (US)
Pages (from-to)1320
Number of pages1
JournalGenome biology and evolution
Volume11
Issue number4
DOIs
StatePublished - Apr 1 2019

All Science Journal Classification (ASJC) codes

  • Ecology, Evolution, Behavior and Systematics
  • Genetics

Fingerprint

Dive into the research topics of 'Corrigendum: Evolutionary genetics of cytoplasmic incompatibility genes cifA and cifB in prophage WO of Wolbachia (Genome Biology and Evolution (2018) 10 (434-451) DOI: 10.1093/gbe/evy012)'. Together they form a unique fingerprint.

Cite this