Skip to main navigation Skip to search Skip to main content

Variability within the rabbit C repeats and sequene shared with other SINES

  • Ross C. Hardison
  • , Richard Printz

Research output: Contribution to journalArticlepeer-review

Abstract

The C family of short, interspersed repeats (SINES) is highly repeated in the rabbit genome, and most members have a structure suggestive of a model for their dispersal via reinsertion of a double-stranded copy of an RNA polymerase III transcribed RNA. We have determined the nucleotide sequence of additional members of the repeat family and have compiled them to obtain an improved consensus sequence. This compilation shows that although most regions of the repeat are well conserved, two regions show high variability. Some individual repeats are truncated, and one truncated repeat retains the characteristic structures of a retroposon. The consensus sequence for C repeats does not match the sequence of any other sequenced mammalian SINE over large regions, but short imperfect matches to several primate and rodent SINES are observed. A sequence similar to the 27 nucleotide consensus sequence . TCCCAGCAACCCACATGGGATGGCATGAGA was found in all mammalian SINES examined. The 3′ portion of this sequence matches a DNA segment found at the replication origins of papovaviruses.

Original languageEnglish (US)
Pages (from-to)1073-1088
Number of pages16
JournalNucleic acids research
Volume13
Issue number4
DOIs
StatePublished - Feb 25 1985

All Science Journal Classification (ASJC) codes

  • Genetics

Fingerprint

Dive into the research topics of 'Variability within the rabbit C repeats and sequene shared with other SINES'. Together they form a unique fingerprint.

Cite this